![]() V-D-J-.XXXA GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'ģ'- CTAGATGTG AGAAAGGGATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCXXX. V-D-J-5'ĥ'- GATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT TTTCTTATATGGGXXX. V-D-J-3'ģ'- CTAGATGTG AGAAAGGGATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCXXX. ![]() V-D-J-.XXX(dT) CATGAGACGCAACTATGGTGACGAA -5'ĥ'- GATCTACAC TCTTTCCCTACACGACGCTCTTCCGATCT TTTCTTATATGGGXXX. V-D-J-.XXX(pA) GTACTCTGCGTTGATACCACTGCTT -3'ģ'- GATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCXXX. (5) Purify GEM-RT products and add Feature cDNA Primers 4 (PN-2000277) to amplify cDNA and Feature together:ĥ'- CTACACGACGCTCTTCCGATCT->ĥ'- CTACACGACGCTCTTCCGATCT TTTCTTATATGGGNNNNNNNNN NNNNNNNNNN CTGTCTCTTATACACATCTCCGAGCCCACGAG -3'ģ'- GATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCNNNNNNNNN NNNNNNNNNN GACAGAGAATATGTGTAGAGGCTCGGGTGCTC -5'ĥ'- CTACACGACGCTCTTCCGATCT TTTCTTATATGGGXXX. |-5'- CTACACGACGCTCTTCCGATCT TTTCTTATATGGGNNNNNNNNN NNNNNNNNNN CTGTCTCTTATACACATCTCCG -3'ģ'- GATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCNNNNNNNNN NNNNNNNNNN GACAGAGAATATGTGTAGAGGC -5' |-5'- CTACACGACGCTCTTCCGATCT TTTCTTATATGGGXXXXXXXXXXXXXXXXXXXXXXB(pA) GTACTCTGCGTTGATACCACTGCTT -3'ģ'- GATGTGCTGCGAGAAGGCTAGA AAAGAATATACCCXXXXXXXXXXXXXXXXXXXXXNV(dT) CATGAGACGCAACTATGGTGACGAA -5' (4) Thhere are two products after GEM-RT: the cDNA is long and the Feature is short: Step-by-step library generation (1) Reverse transcription with Poly-dT RT primer using MMLV: Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Truseq i5 index sequencing primer (index2): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3' Nextera Sample index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3' Truseq Sample index sequencing primer: 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Reverse primer: 5'- CAAGCAGAAGACGGCATACGAGAT GTCTCGTGGGCTCGG -3' Reverse primer: 5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGT -3' Illumina Nextera Read 2 primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'įorward primer: 5'- AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTC -3' Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3' Truseq adapter (double stranded DNA with a T overhang, PN-220026):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' These are the outer primers.įor reverse primers of T/B cell Mix 2 (PN-2000246, 2000255, 2000257, 2000259): check the user guide for the sequence details. The foward primer of T/B Mix 1 & 2 is the same: 5'- GATCTACAC TCTTTCCCTACACGACGC -3'įor reverse primers of T/B cell Mix 1 (PN-2000242, 2000254, 2000256, 2000258): check the user guide for the sequence details. Reverse primer (for FB): 5'- CTCGTGGGCTCGGAGATGTG -3' Reverse primer (for cDNA): 5'- AAGCAGTGGTATCAACGCAGAG -3' Poly-dT RT primer (PN-2000007): 5'- AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'īarcoded oligo (FeatureBarcode, FB) on antibody against surface protein: 5'- CGGAGATGTGTATAAGAGACAGNNNNNNNNNN NNNNNNNNN CCCATATAAGAAA -3'įeature cDNA Primers 4 (for cDNA amplification, PN-2000277, these are a mixture of three primers):įorward primer: 5'- CTACACGACGCTCTTCCGATCT -3' Next GEM Single Cell 5' Gel Beads v2 (PN-1000264 or PN-1000267): |-5'- CTACACGACGCTCTTCCGATCT TTTCTTATATrGrGrG -3' I'm not an expert on this, so I'm not able to comment on the details of these primers. If you blat/map them, you will see they anneal to the constant region of the genes. ![]() ![]() The sequence of those loci specific primer mix can be found in the user guide. Conceptually, this kit is very similar to STRT-seq.įor the VDJ part, the kit basically uses a combination of loci specific (VDJ of B or T cells) primer mix to perform a nested PCR to get the information of VDJ. The antibody against surface proteins has a barcoded oligo that is reverse complement to the TSO on the beads, which will also be captured inside the droplet. Instead of using barcoded RT primers on the beads, the 5' kit uses the same RT primer, but with barcoded Template Swithcing Oligos (TSO) on their gel beads. All three layers of information is shown here to give an overview. If you only need one of them, the basic principle is the same. This kit can profile gene expression (5'), VDJ of BCR and TCR and surface protein. The workflow is based on ther RevA version of the user guide. In this page, the v2 version of The Chromium Single Cell 5’ Immune Profiling Feature Barcoding is shown here. I recommend you contact them to choose the appropriate kit for your application. 10x Chromium 5' Immune Profiling Feature Barcoding 10x Chromium 5' Immune Profiling Feature BarcodingĪs the technology keeps developing, there are quite a few different kits now on the 10x Genomics website.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |